scikit-bio skill
Biological data toolkit. Sequence analysis, alignments, phylogenetic trees, diversity metrics (alpha/beta, UniFrac), ordination (PCoA), PERMANOVA, FASTA/Newick I/O, for microbiome analysis.
Is the scikit-bio skill safe?
Clean: nothing in its files matched our rules. We read 2 files in the folder on 2026-09-28.
No findings.
Install the scikit-bio skill
A skill is a folder. Copy it into your agent's skills folder and the agent loads it when the task matches its description.
git clone --depth 1 https://github.com/K-Dense-AI/scientific-agent-skills.git /tmp/scientific-agent-skills mkdir -p ~/.claude/skills cp -r /tmp/scientific-agent-skills/skills/scikit-bio ~/.claude/skills/scikit-bio
In the Claude apps, zip the folder and upload it from the Skills settings. The folder on GitHub
The instructions your agent would load
SKILL.md as published, without the frontmatter. Read it on GitHub
scikit-bio
Overview
scikit-bio is a comprehensive Python library for working with biological data. Apply this skill for bioinformatics analyses spanning sequence manipulation, alignment, phylogenetics, microbial ecology, and multivariate statistics.
When to Use This Skill
This skill should be used when the user:
- Works with biological sequences (DNA, RNA, protein)
- Needs to read/write biological file formats (FASTA, FASTQ, GenBank, Newick, BIOM, etc.)
- Performs sequence alignments or searches for motifs
- Constructs or analyzes phylogenetic trees
- Calculates diversity metrics (alpha/beta diversity, UniFrac distances)
- Performs ordination analysis (PCoA, CCA, RDA)
- Runs statistical tests on biological/ecological data (PERMANOVA, ANOSIM, Mantel)
- Analyzes microbiome or community ecology data
- Works with protein embeddings from language models
- Needs to manipulate biological data tables
Core Capabilities
1. Sequence Manipulation
Work with biological sequences using specialized classes for DNA, RNA, and protein data.
Key operations:
- Read/write sequences from FASTA, FASTQ, GenBank, EMBL formats
- Sequence slicing, concatenation, and searching
- Reverse complement, transcription (DNA→RNA), and translation (RNA→protein)
- Find motifs and patterns using regex
- Calculate distances (Hamming, k-mer based)
- Handle sequence quality scores and metadata
Common patterns:
import skbio
# Read sequences from file
seq = skbio.DNA.read('input.fasta')
# Sequence operations
rc = seq.reverse_complement()
rna = seq.transcribe()
protein = rna.translate()
# Find motifs
motif_positions = seq.find_with_regex('ATG[ACGT]{3}')
# Check for properties
has_degens = seq.has_degenerates()
seq_no_gaps = seq.degap()Important notes:
- Use DNA, RNA, Protein classes for grammared sequences with validation
- Use Sequence class for generic sequences without alphabet restrictions
- Quality scores automatically loaded from FASTQ files into positional metadata
- Metadata types: sequence-level (ID, description), positional (per-base), interval (regions/features)
2. Sequence Alignment
Perform pairwise and multiple sequence alignments using the pair_align engine (introduced in scikit-bio 0.7.0), a versatile and efficient dynamic-programming aligner.
Key capabilities:
- Global, local, and semi-global alignment (free ends configurable) in one function
- Convenience wrappers pairalignnucl (BLASTN-like) and pairalignprot (BLASTP-like)
- Configurable scoring: match/mismatch tuple or named substitution matrix; linear or affine gap penalties
- PairAlignPath results carry CIGAR strings and convert to aligned sequences
- Multiple sequence alignment storage and manipulation with TabularMSA
Common patterns:
from skbio import DNA, Protein
from skbio.alignment import pair_align_nucl, pair_align_prot, pair_align, TabularMSA
# Nucleotide alignment with BLASTN-like defaults
seq1, seq2 = DNA('ACTACCAGATTACTTACGGATCAGG'), DNA('CGAAACTACTAGATTACGGATCTTA')
aln = pair_align_nucl(seq1, seq2)
aln.score # alignment score (float)
path = aln.paths[0] # PairAlignPath (repr shows CIGAR)
aligned_seqs = path.to_aligned((seq1, seq2)) # list of gapped strings
# Build a TabularMSA from the alignment path + original sequences
msa = TabularMSA.from_path_seqs(path, (seq1, seq2))
# Customize the algorithm via pair_align (default mode='global')
aln = pair_align(seq1, seq2, mode='local') # Smith-Waterman
aln = pair_align(seq1, seq2, sub_score=(2, -3), gap_cost=(5, 2)) # affine gaps
aln = pair_align(seq1, seq2, sub_score='NUC.4.4', gap_cost=3) # substitution matrix, linear gap
# Protein alignment (BLASTP-like, BLOSUM62)
aln = pair_align_prot(Protein('HEAGAWGHEE'), Protein('PAWHEAE'))
# Read a multiple alignment from file and summarize
msa = TabularMSA.read('alignment.fasta', constructor=DNA)
consensus = msa.consensus()Important notes:
- pairalign replaces the removed SSW wrapper (localpairwisealignssw, StripedSmithWaterman) and the deprecated pure-Python aligners (globalpairwisealign, localpairwisealign_nucleotide, etc.)
- The result is a PairAlignResult that also unpacks as score, paths, matrices (use keep_matrices=True to retain the DP matrix)
- subscore accepts a (match, mismatch) tuple or a matrix name (e.g., 'NUC.4.4', 'BLOSUM62'); gapcost accepts a single number (linear) or (open, extend) tuple (affine)
- Parse external CIGAR strings with PairAlignPath.fromcigar('1I8M2D5M2I'); score an existing alignment with alignscore(...) and build a distance matrix from an MSA with align_dists(...)
3. Phylogenetic Trees
Construct, manipulate, and analyze phylogenetic trees representing evolutionary relationships.
Key capabilities:
- Tree construction from distance matrices (UPGMA/WPGMA, Neighbor Joining, GME, BME)
- Tree rearrangement with nearest neighbor interchange (nni)
- Tree manipulation (pruning, rerooting, traversal)
- Distance calculations (patristic via cophenet, Robinson-Foulds via compare_rfd)
- ASCII visualization
- Newick format I/O
Common patterns:
from skbio import TreeNode
from skbio.tree import nj, upgma, gme, bme, rf_dists
# Read tree from file
tree = TreeNode.read('tree.nwk')
# Construct tree from distance matrix
tree = nj(distance_matrix)
# Tree operations
subtree = tree.shear(['taxon1', 'taxon2', 'taxon3'])
tips = [node for node in tree.tips()]
lca = tree.lca(['taxon1', 'taxon2'])
# Calculate distances
patristic_dist = tree.find('taxon1').distance(tree.find('taxon2'))
cophenetic_dm = tree.cophenet() # patristic distance matrix among tips
# Compare two trees (Robinson-Foulds)
rf_distance = tree.compare_rfd(other_tree)
# Pairwise RF distances among many trees -> DistanceMatrix
rf_dm = rf_dists([tree, other_tree, third_tree])Important notes:
- Use nj() for neighbor joining (classic phylogenetic method)
- Use upgma() for UPGMA/WPGMA (assumes molecular clock)
- GME and BME are highly scalable for large trees; refine topology with nni()
- cophenet() (formerly tiptipdistances) returns the patristic distance matrix; comparerfd() is the Robinson-Foulds method (comparewrfd/compare_cophenet for weighted/cophenetic variants)
- lca() is the lowest common ancestor; lowestcommonancestor remains as an alias
- Trees can be rooted or unrooted; some metrics require specific rooting
4. Diversity Analysis
Calculate alpha and beta diversity metrics for microbial ecology and community analysis.
Key capabilities:
- Alpha diversity: richness (sobs, observedfeatures, chao1, ace), Shannon, Simpson, Hill numbers (hill), Faith's PD (faithpd), generalized PD (phydiv), Pielou's evenness
- Beta diversity: Bray-Curtis, Jaccard, weighted/unweighted UniFrac, Euclidean distances
- Phylogenetic diversity metrics (require tree input)
- Rarefaction and subsampling
- Integration with ordination and statistical tests
Common patterns:
from skbio.diversity import alpha_diversity, beta_diversity
# Alpha diversity (phylogenetic metrics take taxa= for tip-name mapping)
alpha = alpha_diversity('shannon', counts_matrix, ids=sample_ids)
faith_pd = alpha_diversity('faith_pd', counts_matrix, ids=sample_ids,
tree=tree, taxa=feature_ids)
# Beta diversity
bc_dm = beta_diversity('braycurtis', counts_matrix, ids=sample_ids)
unifrac_dm = beta_diversity('unweighted_unifrac', counts_matrix,
ids=sample_ids, tree=tree, taxa=feature_ids)
# Get available metrics
from skbio.diversity import get_alpha_diversity_metrics
print(get_alpha_diversity_metrics())Important notes:
- Counts must be integers representing abundances, not relative frequencies
- The phylogenetic-metric argument is taxa= (renamed from otuids in 0.6.0; the old name is a deprecated alias); observedotus is now observed_features (or sobs)
- counts_matrix may be any table-like input (NumPy array, pandas/polars DataFrame, BIOM Table, or AnnData) via the dispatch system
- Phylogenetic metrics (Faith's PD, UniFrac) require tree and taxa-to-tip mapping
- Use partialbetadiversity() for specific sample pairs, or blockbetadiversity() for large block-decomposed calculations
- Alpha diversity returns a pandas.Series, beta diversity returns a DistanceMatrix
5. Ordination Methods
Reduce high-dimensional biological data to visualizable lower-dimensional spaces.
Key capabilities:
- PCoA (Principal Coordinate Analysis) from distance matrices
- CA (Correspondence Analysis) for contingency tables
- CCA (Canonical Correspondence Analysis) with environmental constraints
- RDA (Redundancy Analysis) for linear relationships
- Biplot projection for feature interpretation
Common patterns:
from skbio.stats.ordination import pcoa, cca
import skbio
# PCoA from distance matrix (limit dimensions for large matrices)
pcoa_results = pcoa(distance_matrix, dimensions=3)
pc1 = pcoa_results.samples['PC1']
pc2 = pcoa_results.samples['PC2']
# Built-in scatter plot colored by a metadata column
fig = pcoa_results.plot(sample_metadata, column='bodysite')
# CCA with environmental variables
cca_results = cca(species_matrix, environmental_matrix)
# Save/load ordination results
pcoa_results.write('ordination.txt')
results = skbio.OrdinationResults.read('ordination.txt')Important notes:
- PCoA works with any distance/dissimilarity matrix; pass dimensions as an int (count) or a float in (0, 1] (fraction of cumulative variance to retain)
- OrdinationResults exposes pandas-based attributes: samples, features, eigvals, proportionexplained, biplotscores, sample_constraints
- CCA reveals environmental drivers of community composition
- OrdinationResults.plot() produces a matplotlib figure; results also integrate with seaborn/plotly
6. Statistical Testing
Perform hypothesis tests specific to ecological and biological data.
Key capabilities:
- PERMANOVA: test group differences using distance matrices
- ANOSIM: alternative test for group differences
- PERMDISP: test homogeneity of group dispersions
- Mantel test: correlation between distance matrices
- Bioenv: find environmental variables correlated with distances
- Differential abundance: ancom, dirmultttest, and dirmultlme (longitudinal mixed-effects) in skbio.stats.composition
Common patterns:
from skbio.stats.distance import permanova, anosim, mantel
# Test if groups differ significantly
permanova_results = permanova(distance_matrix, grouping, permutations=999)
print(f"p-value: {permanova_results['p-value']}")
# ANOSIM test
anosim_results = anosim(distance_matrix, grouping, permutations=999)
# Mantel test between two distance matrices
mantel_results = mantel(dm1, dm2, method='pearson', permutations=999)
print(f"Correlation: {mantel_results[0]}, p-value: {mantel_results[1]}")
# Differential abundance on a feature table (raw counts recommended)
from skbio.stats.composition import dirmult_ttest
da = dirmult_ttest(counts_table, grouping, treatment='caseA', reference='control')Important notes:
- Permutation tests provide non-parametric significance testing
- Use 999+ permutations for robust p-values
- PERMANOVA sensitive to dispersion differences; pair with PERMDISP
- Mantel tests assess matrix correlation (e.g., geographic vs genetic distance)
- Supply differential-abundance tests with raw counts, not pre-normalized proportions, to preserve magnitude information
7. File I/O and Format Conversion
Read and write 19+ biological file formats with automatic format detection.
Supported formats:
- Sequences: FASTA, FASTQ, GenBank, EMBL, QSeq
- Alignments: Clustal, PHYLIP, Stockholm
- Trees: Newick
- Tables: BIOM (HDF5 and JSON)
- Distances: delimited square matrices
- Analysis: BLAST+6/7, GFF3, Ordination results
- Metadata: TSV/CSV with validation
Common patterns:
More skills from K-Dense-AI/scientific-agent-skills
- AadaptyvHow to use the Adaptyv Bio Foundry API and Python SDK for protein experiment design, submission, and results retrieval. Use this skill whenever the user mentions Adaptyv, Foundry API, protein binding assays, protein screening experiments, BLI/SPR assays, thermostability assays, or wants to submit protein sequences for experimental characterization. Also trigger when code imports `adaptyv`, `adaptyv_sdk`, or `FoundryClient`, or references `foundry-api-public.adaptyvbio.com`.
- AaeonThis skill should be used for time series machine learning tasks including classification, regression, clustering, forecasting, anomaly detection, segmentation, and similarity search. Use when working with temporal data, sequential patterns, or time-indexed observations requiring specialized algorithms beyond standard ML approaches. Particularly suited for univariate and multivariate time series analysis with scikit-learn compatible APIs.
- AalphagenomeLook up precomputed AlphaGenome Atlas effects for any GRCh38 single-nucleotide variant (AVI score with Phred and 18 SHAP feature attributions, plus raw and quantile scores for RNA-seq, DNase, ATAC, ChIP-TF, ChIP-histone, CAGE, PRO-cap, splicing, polyadenylation and contact-map tracks), score variants or scan windows on demand with the AlphaGenome model for human and mouse (variant scoring, in silico mutagenesis, REF-versus-ALT track prediction), and build Atlas website deep links. Use when the user mentions AlphaGenome, AlphaGenome Atlas, AVI or AlphaGenome Variant Impact, DeepMind variant effect prediction, or wants to prioritise or mechanistically interpret non-coding, regulatory, splicing, enhancer, promoter, or chromatin-accessibility effects of SNVs from a VCF, credible set, or region. Research use only; not a clinical tool.
- Aanalytical-method-validationPlan, execute, and document validation, verification, and transfer of analytical procedures under the governing framework - ICH Q2(R2) and Q14, USP <1220>/<1225>/<1226>, ICH M10 bioanalytical, CLSI EP, or ISO/IEC 17025. Use for HPLC, LC-MS/MS, GC, CE, ICP-MS, dissolution, qNMR, qPCR, NIR, and ligand binding or cell-based assays whenever the question is whether a procedure is fit for its intended purpose. Triggers include "method validation", "analytical method validation", "AMV", "validation protocol", "acceptance criteria", "linearity", "reportable range", "accuracy and precision", "repeatability", "intermediate precision", "recovery", "LOD", "LOQ", "detection limit", "quantitation limit", "specificity", "robustness", "method transfer", "method comparison", "Deming", "Passing-Bablok", "Bland-Altman", "equivalence testing", "OOS investigation", "ICH Q2", "Q2(R2)", "Q14", "USP 1225", "ICH M10", "incurred sample reanalysis", "ISR", "CLSI EP", and any request to show that an assay works.
- AanndataData structure for annotated matrices in single-cell analysis. Use when working with .h5ad files or integrating with the scverse ecosystem. This is the data format skill—for analysis workflows use scanpy; for probabilistic models use scvi-tools; for population-scale queries use cellxgene-census.
- AarborAutonomously improve a real artifact (code, training recipe, agent harness, data pipeline, prompt) against an objective and an evaluator, using Hypothesis Tree Refinement (HTR) from the Arbor paper. Use this whenever someone wants to iteratively optimize something over many experiments without overfitting — e.g. "get my model's eval score up", "improve this agent/harness", "tune this pipeline", "beat the baseline on this benchmark", "run a search over approaches and keep the best", "do an MLE-bench / Kaggle-style optimization", or any long-horizon "make this artifact better and don't just memorize the dev set" task. Trigger it even when the user doesn't say "Arbor" or "hypothesis tree" but describes repeated experiment-and-evaluate loops, branching exploration of competing ideas, or worries about a dev/test gap. Runs Claude itself as the coordinator with subagent executors in isolated git worktrees; for the standalone `arbor` CLI tool see references/arbor-upstream.md.
- AarboretoInfer gene regulatory networks (GRNs) from gene expression data using scalable algorithms (GRNBoost2, GENIE3). Use when analyzing transcriptomics data (bulk RNA-seq, single-cell RNA-seq) to identify transcription factor-target gene relationships and regulatory interactions. Supports distributed computation for large-scale datasets.
- AastropyCore Python library for astronomy and astrophysics workflows that need Astropy APIs, including units/quantities, coordinates, FITS I/O, tables, time systems, WCS, and cosmology. Use when implementing or debugging astronomical data analysis code with Astropy.
- AautoskillObserve the user's screen via screenpipe, detect repeated research workflows, match them against existing scientific-agent-skills, and draft new skills (or composition recipes that chain existing ones) for the patterns not yet covered. Use when the user asks to analyze their recent work and propose skills based on what they actually do. Requires the screenpipe daemon (https://github.com/screenpipe/screenpipe) running locally on port 3030 — the skill has no other data source and will refuse to run if screenpipe is unreachable. All detection runs locally; only redacted cluster summaries reach the LLM.
- Abenchling-integrationBenchling Python SDK and REST API integration for registry entities, inventory, ELN entries, workflows, Benchling Apps, and Data Warehouse queries. Use when automating lab data with benchling-sdk or the v2 API.
- Abgpt-paper-searchSearch scientific papers and retrieve structured experimental data extracted from full-text studies via the BGPT MCP server. Returns 25+ fields per paper including methods, results, sample sizes, quality scores, and conclusions. Use for literature reviews, evidence synthesis, and finding experimental details not available in abstracts alone.
- AbidsUse this skill when working with Brain Imaging Data Structure (BIDS) datasets: organizing neuroscience and biomedical data (MRI, EEG, MEG, iEEG, PET, microscopy, NIRS, motion capture, EMG, MR spectroscopy, behavioral), querying BIDS layouts, validating compliance, converting DICOM to BIDS, writing metadata sidecars, or creating BIDS derivatives.